Sequence retrieval

Genome: Pelagibacter ubique HTCC1062
Start position: 177711
End position: 177735
Length: 25

DNA sequence
>NC_007205, from 177711 to 177735 (25 bp); Pelagibacter ubique HTCC1062 TTTTTTGTTTTTTCTTATTTGTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 176702-177877	Sequence	SAR11_0174 - hypothetical protein (Protein is coded in complementary strand; from 177877 to 176702)