Sequence retrieval

Genome: Pelagibacter ubique HTCC1062
Start position: 158563
End position: 158592
Length: 30

DNA sequence
>NC_007205, from 158563 to 158592 (30 bp); Pelagibacter ubique HTCC1062 TTTGATAATTTTTTATATTTTTTAATTATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 157582-158724	Sequence	SAR11_0155 pgi glucose-6-phosphate isomerase (Protein is coded in complementary strand; from 158724 to 157582)