Sequence retrieval

Genome: Pelagibacter ubique HTCC1062
Start position: 1208645
End position: 1208671
Length: 27

DNA sequence
>NC_007205, from 1208645 to 1208671 (27 bp); Pelagibacter ubique HTCC1062 TTAGAAAAATTAGTAAAATTAAAAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1208130-1209176	Sequence	SAR11_1272 purE phosphoribosylaminoimidazole carboxylase ATPase chain