Sequence retrieval

Genome: Pelagibacter ubique HTCC1062
Start position: 1170634
End position: 1170663
Length: 30

DNA sequence
>NC_007205, from 1170634 to 1170663 (30 bp); Pelagibacter ubique HTCC1062 ACCCATTCCCACACATTACCACCCATTGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1170490-1171194	Sequence	SAR11_1225 - hypothetical protein (Protein is coded in complementary strand; from 1171194 to 1170490)