Sequence retrieval

Genome: Pelagibacter ubique HTCC1062
Start position: 1082911
End position: 1082934
Length: 24

DNA sequence
>NC_007205, from 1082911 to 1082934 (24 bp); Pelagibacter ubique HTCC1062 CTGCTGCTGCTGCTGGTGCTGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1082679-1083044	Sequence	SAR11_1124 rplL 50S ribosomal protein L31 (Protein is coded in complementary strand; from 1083044 to 1082679)