Sequence retrieval

Genome: Pelagibacter ubique HTCC1062
Start position: 1069922
End position: 1069946
Length: 25

DNA sequence
>NC_007205, from 1069922 to 1069946 (25 bp); Pelagibacter ubique HTCC1062 TTTTATTTAATTTTCTTTTTTTGTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1069609-1070232	Sequence	SAR11_1116 rplD 50S ribosomal protein L4 (Protein is coded in complementary strand; from 1070232 to 1069609)