Sequence retrieval

Genome: Pelagibacter ubique HTCC1062
Start position: 1060027
End position: 1060051
Length: 25

DNA sequence
>NC_007205, from 1060027 to 1060051 (25 bp); Pelagibacter ubique HTCC1062 TATTTTTTTTTATTTTCTTTTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1059684-1060136	Sequence	SAR11_1094 rpsK 30S ribosomal protein S11 (Protein is coded in complementary strand; from 1060136 to 1059684)