Sequence retrieval

Genome: Pelagibacter ubique HTCC1062
Start position: 1021432
End position: 1021456
Length: 25

DNA sequence
>NC_007205, from 1021432 to 1021456 (25 bp); Pelagibacter ubique HTCC1062 AAATAAAACAAAAAAAAATGAAATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1021179-1022168	Sequence	SAR11_1051 hemB delta-aminolevulinic acid dehydratase