Sequence retrieval

Genome: Staphylococcus haemolyticus JCSC1435
Start position: 54061
End position: 54085
Length: 25

DNA sequence
>NC_007168, from 54061 to 54085 (25 bp); Staphylococcus haemolyticus JCSC1435 TATTTTATTATATTTGATTTCATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 54061-54927	Sequence	SH0044 - hypothetical protein (Protein is coded in complementary strand; from 54927 to 54061)