Sequence retrieval

Genome: Staphylococcus haemolyticus JCSC1435
Start position: 296616
End position: 296639
Length: 24

DNA sequence
>NC_007168, from 296616 to 296639 (24 bp); Staphylococcus haemolyticus JCSC1435 AAGAAAAAGTAAAACAAAAATAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 295735-296937	Sequence	SH0298 - hypothetical protein (Protein is coded in complementary strand; from 296937 to 295735)