Sequence retrieval

Genome: Staphylococcus haemolyticus JCSC1435
Start position: 2616920
End position: 2616949
Length: 30

DNA sequence
>NC_007168, from 2616920 to 2616949 (30 bp); Staphylococcus haemolyticus JCSC1435 TTTTTTGACGTTTTTAGTCGTTTCTTGAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2616897-2618339	Sequence	SH2608 tnp transposase for Tn552 (Protein is coded in complementary strand; from 2618339 to 2616897)