Sequence retrieval

Genome: Staphylococcus haemolyticus JCSC1435
Start position: 2568850
End position: 2568873
Length: 24

DNA sequence
>NC_007168, from 2568850 to 2568873 (24 bp); Staphylococcus haemolyticus JCSC1435 AATAAGAATAAGATTAAGAATATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2568460-2569710	Sequence	SH2552 - hypothetical protein (Protein is coded in complementary strand; from 2569710 to 2568460)