Sequence retrieval

Genome: Staphylococcus haemolyticus JCSC1435
Start position: 2359042
End position: 2359071
Length: 30

DNA sequence
>NC_007168, from 2359042 to 2359071 (30 bp); Staphylococcus haemolyticus JCSC1435 TGGTTTTGGTTTAGGTTTGGGTTTAGGTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2357588-2359531	Sequence	SH2336 - hypothetical protein (Protein is coded in complementary strand; from 2359531 to 2357588)