Sequence retrieval

Genome: Staphylococcus haemolyticus JCSC1435
Start position: 1457091
End position: 1457117
Length: 27

DNA sequence
>NC_007168, from 1457091 to 1457117 (27 bp); Staphylococcus haemolyticus JCSC1435 GGTGCAGCTGGTGCGGCTGGCGCAGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1456282-1457901	Sequence	SH1431 ebpS cell surface elastin binding protein EbpS