Sequence retrieval

Genome: Staphylococcus haemolyticus JCSC1435
Start position: 1825043
End position: 1825072
Length: 30

DNA sequence
>NC_007168, from 1825043 to 1825072 (30 bp); Staphylococcus haemolyticus JCSC1435 TTTTTTGACGTTTTTAGTCGTTTCTTGAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1825020-1826462	Sequence	SH1760 tnp transposase for Tn552 (Protein is coded in complementary strand; from 1826462 to 1825020)