Sequence retrieval

Genome: Pseudomonas syringae pv. syringae B728a
Start position: 838605
End position: 838628
Length: 24

DNA sequence
>NC_007005, from 838605 to 838628 (24 bp); Pseudomonas syringae pv. syringae B728a GCGAACGCGAACGCGAACGCGAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 838293-839249	Sequence	Psyr_0733 - relaxase (Protein is coded in complementary strand; from 839249 to 838293)