Sequence retrieval

Genome: Pseudomonas syringae pv. syringae B728a
Start position: 5840950
End position: 5840997
Length: 48

DNA sequence
>NC_007005, from 5840950 to 5840997 (48 bp); Pseudomonas syringae pv. syringae B728a CTTCCGGGGTGACTTCCGGGGTGGCTTCCGGGGCGACTTCCGGGGTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5840727-5841323	Sequence	Psyr_4927 - ATP-dependent DNA helicase recG (Protein is coded in complementary strand; from 5841323 to 5840727)