Sequence retrieval

Genome: Pseudomonas syringae pv. syringae B728a
Start position: 575835
End position: 575870
Length: 36

DNA sequence
>NC_007005, from 575835 to 575870 (36 bp); Pseudomonas syringae pv. syringae B728a AGCAGGGGCAGGGGCAGGGGCAGGGGCAGGGGCAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 574465-576138	Sequence	Psyr_0517 - dihydrolipoamide acetyltransferase (Protein is coded in complementary strand; from 576138 to 574465)