Sequence retrieval

Genome: Pseudomonas syringae pv. syringae B728a
Start position: 5627453
End position: 5627482
Length: 30

DNA sequence
>NC_007005, from 5627453 to 5627482 (30 bp); Pseudomonas syringae pv. syringae B728a CTGGCTCTGGCTCTGGCTCTGGCTCTGGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5626435-5627952	Sequence	Psyr_4751 - cell division transporter substrate-binding protein FtsY (Protein is coded in complementary strand; from 5627952 to 5626435)