Sequence retrieval

Genome: Pseudomonas syringae pv. syringae B728a
Start position: 55035
End position: 55070
Length: 36

DNA sequence
>NC_007005, from 55035 to 55070 (36 bp); Pseudomonas syringae pv. syringae B728a CGGCAGGCTTGGCCGCAGGTTTGGCGACAGGCTTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 54905-55921	Sequence	Psyr_0054 - alginate regulatory protein AlgR3 (Protein is coded in complementary strand; from 55921 to 54905)