Sequence retrieval

Genome: Pseudomonas syringae pv. syringae B728a
Start position: 510086
End position: 510112
Length: 27

DNA sequence
>NC_007005, from 510086 to 510112 (27 bp); Pseudomonas syringae pv. syringae B728a CAGCACCAGCACCACCAGCAGCACCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 510060-510383	Sequence	Psyr_0470 - hypothetical protein (Protein is coded in complementary strand; from 510383 to 510060)