Sequence retrieval

Genome: Pseudomonas syringae pv. syringae B728a
Start position: 3386817
End position: 3386882
Length: 66

DNA sequence
>NC_007005, from 3386817 to 3386882 (66 bp); Pseudomonas syringae pv. syringae B728a CCTTGCCCGGATTTTTTTCCGACCTTGATCGGATTTTTTTCCGAGGTAGCTCGGATTTTTTTCCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3386259-3387236	Sequence	Psyr_2810 - hypothetical protein (Protein is coded in complementary strand; from 3387236 to 3386259)