Sequence retrieval

Genome: Pseudomonas syringae pv. syringae B728a
Start position: 2758922
End position: 2758948
Length: 27

DNA sequence
>NC_007005, from 2758922 to 2758948 (27 bp); Pseudomonas syringae pv. syringae B728a CACCGCAATCAGCGCAATCACCGCAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2758476-2759789	Sequence	Psyr_2379 - amino acid permease (Protein is coded in complementary strand; from 2759789 to 2758476)