Sequence retrieval

Genome: Pseudomonas syringae pv. syringae B728a
Start position: 2371871
End position: 2371894
Length: 24

DNA sequence
>NC_007005, from 2371871 to 2371894 (24 bp); Pseudomonas syringae pv. syringae B728a GGTCTTGATCTTGATCTTGATCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2369211-2374259	Sequence	Psyr_2040 - YD repeat-containing protein (Protein is coded in complementary strand; from 2374259 to 2369211)