Sequence retrieval

Genome: Pseudomonas syringae pv. syringae B728a
Start position: 1894351
End position: 1894374
Length: 24

DNA sequence
>NC_007005, from 1894351 to 1894374 (24 bp); Pseudomonas syringae pv. syringae B728a GATCGAGTTCGAGATCTACATCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1893879-1894769	Sequence	Psyr_1685 ppnK inorganic polyphosphate/ATP-NAD kinase