Sequence retrieval

Genome: Pseudomonas syringae pv. syringae B728a
Start position: 1106395
End position: 1106421
Length: 27

DNA sequence
>NC_007005, from 1106395 to 1106421 (27 bp); Pseudomonas syringae pv. syringae B728a TCTGCTCGGCCTGCTCGGCCTGCTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1105608-1106450	Sequence	Psyr_0973 - amino acid ABC transporter permease (Protein is coded in complementary strand; from 1106450 to 1105608)