Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67
Start position: 4234625
End position: 4234661
Length: 37

DNA sequence
>NC_006905, from 4234625 to 4234661 (37 bp); Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67 CCACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4234152-4235147	Sequence	SC3982 ftsN cell division protein FtsN (Protein is coded in complementary strand; from 4235147 to 4234152)