Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67
Start position: 2586830
End position: 2586859
Length: 30

DNA sequence
>NC_006905, from 2586830 to 2586859 (30 bp); Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67 ACGCCGTCGCACGCCGCCTCACGCAGTTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2585972-2587159	Sequence	SC2457 eutG transport protein in ethanolamine utilization (Protein is coded in complementary strand; from 2587159 to 2585972)