Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67
Start position: 2365775
End position: 2365801
Length: 27

DNA sequence
>NC_006905, from 2365775 to 2365801 (27 bp); Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67 GCAGCGCCAGCAGCGCCAGCGGCGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2365675-2365887	Sequence	SC2256 ccmD heme exporter protein C, cytochrome c-type biogenesis protein (Protein is coded in complementary strand; from 2365887 to 2365675)