Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67
Start position: 2014907
End position: 2014932
Length: 26

DNA sequence
>NC_006905, from 2014907 to 2014932 (26 bp); Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67 AAGCAATAAGCAATAAGCAATAAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2014636-2015082	Sequence	SC1905 - hypothetical protein (Protein is coded in complementary strand; from 2015082 to 2014636)