Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67
Start position: 180324
End position: 180369
Length: 46

DNA sequence
>NC_006905, from 180324 to 180369 (46 bp); Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67 CATGATGGTAATCATCATGATGGTCGTCGTCATGGTGGTGATGATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 179600-181219	Sequence	SC0156 yacH hypothetical protein (Protein is coded in complementary strand; from 181219 to 179600)