Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67
Start position: 1346755
End position: 1346781
Length: 27

DNA sequence
>NC_006905, from 1346755 to 1346781 (27 bp); Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67 GCGGCAGCCGCATCGGCAGCCGCAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1346171-1348849	Sequence	SC1236 stf side tail fiber protein
ORF. 1346587-1347102	Sequence	SC1237 - hypothetical protein (Protein is coded in complementary strand; from 1347102 to 1346587)