Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67
Start position: 1311313
End position: 1311337
Length: 25

DNA sequence
>NC_006905, from 1311313 to 1311337 (25 bp); Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67 TACGGTCATGCGGTCATGCGGTCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1310966-1311322	Sequence	SC1194 yfdP hypothetical protein (Protein is coded in complementary strand; from 1311322 to 1310966)