Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67
Start position: 1215985
End position: 1216014
Length: 30

DNA sequence
>NC_006905, from 1215985 to 1216014 (30 bp); Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67 ACGAAAAATAACCAGAAATAACAAAAAATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1215045-1216199	Sequence	SC1096 mdoC glucans biosynthesis protein (Protein is coded in complementary strand; from 1216199 to 1215045)