Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67
Start position: 4273751
End position: 4273782
Length: 32

DNA sequence
>NC_006905, from 4273751 to 4273782 (32 bp); Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67 CGCGGTAAATCTCGATAAATGGCGGTAAAACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4272640-4273791	Sequence	SC4010 argE acetylornithine deacetylase (Protein is coded in complementary strand; from 4273791 to 4272640)