Sequence retrieval

Genome: Thermococcus kodakaraensis KOD1
Start position: 1494654
End position: 1494677
Length: 24

DNA sequence
>NC_006624, from 1494654 to 1494677 (24 bp); Thermococcus kodakaraensis KOD1 ATTTCCGTTTCCATTGCCGTTTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1494424-1495371	Sequence	TK1702 - hypothetical protein (Protein is coded in complementary strand; from 1495371 to 1494424)