Sequence retrieval

Genome: Thermococcus kodakaraensis KOD1
Start position: 1241968
End position: 1241995
Length: 28

DNA sequence
>NC_006624, from 1241968 to 1241995 (28 bp); Thermococcus kodakaraensis KOD1 CTTCCTCCTCTTCCTCTTCTTCCTCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1241922-1242944	Sequence	TK1416 rplP0 acidic ribosomal protein P0 (Protein is coded in complementary strand; from 1242944 to 1241922)