Sequence retrieval

Genome: Thermococcus kodakaraensis KOD1
Start position: 1192641
End position: 1192671
Length: 31

DNA sequence
>NC_006624, from 1192641 to 1192671 (31 bp); Thermococcus kodakaraensis KOD1 CCTGGGGATTCTTGGTGATTTCGGGGGATTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1192334-1192999	Sequence	TK1360 - hypothetical protein (Protein is coded in complementary strand; from 1192999 to 1192334)