Sequence retrieval

Genome: Thermococcus kodakaraensis KOD1
Start position: 1082055
End position: 1082078
Length: 24

DNA sequence
>NC_006624, from 1082055 to 1082078 (24 bp); Thermococcus kodakaraensis KOD1 CAAAACCAGAACCAACACCAAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1081754-1082302	Sequence	TK1233 - hypothetical protein (Protein is coded in complementary strand; from 1082302 to 1081754)