Sequence retrieval

Genome: Streptococcus thermophilus LMG 18311
Start position: 322885
End position: 322920
Length: 36

DNA sequence
>NC_006448, from 322885 to 322920 (36 bp); Streptococcus thermophilus LMG 18311 AGTTCCGCCACCATTTCCGCCACCATTTCCGCCACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 322838-323665	Sequence	stu0332 manM mannose PTS system component IIC (Protein is coded in complementary strand; from 323665 to 322838)