Sequence retrieval

Genome: Streptococcus thermophilus LMG 18311
Start position: 774429
End position: 774460
Length: 32

DNA sequence
>NC_006448, from 774429 to 774460 (32 bp); Streptococcus thermophilus LMG 18311 CATATCATGCATATCATGCATATCATGCATAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 772420-774627	Sequence	stu0840 copB Cu2+-Cu+-Ag+-P-type ATPase (Protein is coded in complementary strand; from 774627 to 772420)