Sequence retrieval

Genome: Streptococcus thermophilus LMG 18311
Start position: 1360374
End position: 1360404
Length: 31

DNA sequence
>NC_006448, from 1360374 to 1360404 (31 bp); Streptococcus thermophilus LMG 18311 CATTTTAACTCCTATTAACTCCTATTAACTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1359577-1360377	Sequence	stu1543 folP dihydropteroate synthase (Protein is coded in complementary strand; from 1360377 to 1359577)