Sequence retrieval

Genome: Streptococcus thermophilus LMG 18311
Start position: 1360378
End position: 1360407
Length: 30

DNA sequence
>NC_006448, from 1360378 to 1360407 (30 bp); Streptococcus thermophilus LMG 18311 TTAACTCCTATTAACTCCTATTAACTCCTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1360406-1360969	Sequence	stu1544 folE GTP cyclohydrolase I (Protein is coded in complementary strand; from 1360969 to 1360406)