Sequence retrieval

Genome: Streptococcus thermophilus LMG 18311
Start position: 1234702
End position: 1234725
Length: 24

DNA sequence
>NC_006448, from 1234702 to 1234725 (24 bp); Streptococcus thermophilus LMG 18311 GCCTTTTTGCCATTTTGCCTTTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1234569-1235615	Sequence	stu1399 galM aldose 1-epimerase (Protein is coded in complementary strand; from 1235615 to 1234569)