Sequence retrieval

Genome: Bacillus licheniformis DSM 13
Start position: 677727
End position: 677762
Length: 36

DNA sequence
>NC_006322, from 677727 to 677762 (36 bp); Bacillus licheniformis DSM 13 TGTTTTATCTGTTTTATTCGTTTTATCTGTTTTATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 677605-677862	Sequence	BLi00674 - hypothetical protein (Protein is coded in complementary strand; from 677862 to 677605)