Sequence retrieval

Genome: Bacillus licheniformis DSM 13
Start position: 624497
End position: 624521
Length: 25

DNA sequence
>NC_006322, from 624497 to 624521 (25 bp); Bacillus licheniformis DSM 13 TTTTTTCTTTTTTGTTTTGTTTGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 624424-625200	Sequence	BLi00620 tatCY twin-arginine translocase component TatCY