Sequence retrieval

Genome: Bacillus licheniformis DSM 13
Start position: 4187802
End position: 4187832
Length: 31

DNA sequence
>NC_006322, from 4187802 to 4187832 (31 bp); Bacillus licheniformis DSM 13 TATATTTTTTTATTTTTTTCTATTATTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 4187825-4188235	Sequence	BLi04340 - NUDIX hydrolase family protein (Protein is coded in complementary strand; from 4188235 to 4187825)