Sequence retrieval

Genome: Bacillus licheniformis DSM 13
Start position: 2749297
End position: 2749327
Length: 31

DNA sequence
>NC_006322, from 2749297 to 2749327 (31 bp); Bacillus licheniformis DSM 13 AACAAATTTTATGAAATTTTCACAATTTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 2749306-2749782	Sequence	BLi02860 greA transcription elongation factor GreA (Protein is coded in complementary strand; from 2749782 to 2749306)