Sequence retrieval

Genome: Bacillus licheniformis DSM 13
Start position: 2494111
End position: 2494134
Length: 24

DNA sequence
>NC_006322, from 2494111 to 2494134 (24 bp); Bacillus licheniformis DSM 13 CATCGCCAGCGCCCTCGCAATCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2493848-2494576	Sequence	BLi02574 artR high affinity arginine ABC transporter ATP-binding protein ArtR (Protein is coded in complementary strand; from 2494576 to 2493848)