Sequence retrieval

Genome: Bacillus licheniformis DSM 13
Start position: 1477681
End position: 1477705
Length: 25

DNA sequence
>NC_006322, from 1477681 to 1477705 (25 bp); Bacillus licheniformis DSM 13 TGTTTATGTGTATGCTTATGTTTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1476790-1478139	Sequence	BLi01504 ktrD low affinity potassium transporter integral membrane subunit KtrD